                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-16.70 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -4.10 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCCTGACCATGGAAGACATCGGCCAACTCGACATTGCCGACTCCAGGGCGCTGACC
GACTTTTTTCGCCGTATGGCTGAAGGAAGCACCGAATCTGAAAGCAGCTGAcgaagccctgc
tgtattggctgcggattcagccgtctgaaatagacgctctcgacatggaagagtacatgcaatgggcagatatggcggtgcgagtctggaaagcccacaa
ccaggaataggctaaatcgttcacgcacaactttgccgccatcgttaatcgctggcggcatttttcatataggcggcaccATG

    CV1474 Gene: CV1474     GI: 34496929     BI number: CV1474     GOG: COG5283     Description: probable bacteriophage protei aa        ac c  c      c  g a  c      t  c c  a       ta cg        gc cg       c  a g  a      t  a a  a      a  c a  |      a  t a  |      a  t g  |      t  t gt        cg ta        gc         a cg        gc       t  a tg       a  g      t  t gc       t  |       gc at       a  |       cg g  a      a  |      t  c c  a       gc        at g  |       gc        cg ta       |  a       cg gt       a  t       gc gc       c  c       cg cg        cg        cg gt        at        gc gt        at        ta                         tttttcatataggcggcaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5283 Phage-related tail protein ... can be seen here     ..................................................................................................................