Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:146 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -6.00 kcal/mol
Antiterminator: Size=67 nt.     Delta G=-18.70 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-13.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aagggccgtggcatcacccaccaatgggacaggtagcgttgcgggagggattttcacgggttgcaaaggtgttgcagattccggtatcctgaaactcggt
gctcaaaacacctactgtcagcggtcgccgcgcccgaaagatatgcggtttttttgcgtccatagatttcctatggccgggtgtgaggctaatacaagac
tcccgcaaggggggaatacgcccgccgtctgacagcggttttgagcccccggccaccctctcaaaaagggtaaattcaaaatatctgtcaggaggccatc
ATG

    CV1476


Gene: CV1476     GI: 34496931     BI number: CV1476     GOG: -------     Description: hypothetical protei


            a
          c  a
          t  a
          c  a
           gc
           ta
           gc
           gc
          c  t
          t  a
          c  c
          a  t
          a  g
  g        at
g  t       gc
a  g       ta
 at        cg
 at       c  |
 cg       t  |
 gc       a  |
 ta       t  |
 tg       g  |
|  a       gc
|  t       cg
 gt        cg
 gc       t  |
 gc       t  |        a
 cg        at       a  a
a  g       gc       g  g
c  t      a  |      c  a
t  |       cg       c  t
t  |       gc       c  a
t  |      t  c       gt
 ta        tg        cg
 at        gc        gc
 gc        tg        cg
 gc        gc        cg
 gt        gc        gt
                        ttttttgcgtccatagatttcctatggccgggtgtgaggctaatacaagactcccgcaaggggggaatacgcccgccgtctgacagcggttttgagcccccggccaccctctcaaaaagggtaaattcaaaatatctgtcaggaggccatcATG


    ..................................................................................................................