                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G=-19.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-10.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTTCAGCTGCTATGGATCGACTGGGGCAACGGCACGCTGCCGCGCCCGGAAATCCAC
ACCAAGGCCACACTGAAGGCCCGCCGCAGAGTAGAACACAAGCAAAATCAATACTTCA
AAGCAATACAGGATCAAATGGCCCAGTCCTCAGCACCGGATGCCGGTAACTGAcagcacgc
ccccgaatatcgggggcgttcgtttttaaactgttttggacaacgccgtttaaaaccttcgagatactgacgcgatcatggccagaaccatgacccctcg
acatgctgcgcaaggagaaaaccATG

    CV1477 Gene: CV1477     GI: 34496932     BI number: CV1477     GOG: NOG43070     Description: conserved hypothetical protei   T A  G GC GC CG CG AT |  A C  A GC AT         t CG       a  a TA       a  t C  c       gc C  a       cg Tg        cg Gc        cg A  a       cg C  c       cg C  |       gc Cg        cg Gc        at             tcgtttttaaactgttttggacaacgccgtttaaaaccttcgagatactgacgcgatcatggccagaaccatgacccctcgacatgctgcgcaaggagaaaaccATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_violaceum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:95 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G=-19.60 kcal/mol Antiterminator: Size=41 nt.     Delta G=-10.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTTCAGCTGCTATGGATCGACTGGGGCAACGGCACGCTGCCGCGCCCGGAAATCCAC ACCAAGGCCACACTGAAGGCCCGCCGCAGAGTAGAACACAAGCAAAATCAATACTTCA AAGCAATACAGGATCAAATGGCCCAGTCCTCAGCACCGGATGCCGGTAACTGAcagcacgc ccccgaatatcgggggcgttcgtttttaaactgttttggacaacgccgtttaaaaccttcgagatactgacgcgatcatggccagaaccatgacccctcg acatgctgcgcaaggagaaaaccATG     CV1477 Gene: CV1477     GI: 34496932     BI number: CV1477     GOG: NOG43070     Description: conserved hypothetical protei   T A  G GC GC CG CG AT |  A C  A GC AT         t CG       a  a TA       a  t C  c       gc C  a       cg Tg        cg Gc        cg A  a       cg C  c       cg C  |       gc Cg        cg Gc        at             tcgtttttaaactgttttggacaacgccgtttaaaaccttcgagatactgacgcgatcatggccagaaccatgacccctcgacatgctgcgcaaggagaaaaccATG     ..................................................................................................................