                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-14.80 kcal/mol
Antiterminator: Size=70 nt.     Delta G=-20.10 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-10.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCTGCATTTGGATGATGCGGTTAACCGCTCCGCAATGCTGGTGGCCGAAGTGCGCAA
CGAGTTGGATAAGCGATTTGGCGGAGATATTGCAGCAGCTCGCAGCAATGTTTTACGT
GAAGAGGCTTGAgatggtttgacctgcgatatgagccgccagatcaggctgatctgttcaagcaccagtcccccgtttatcgggggatttt
ttcatcactaacgtacattaagtatcgctcaacccctattcctaacgatcattacgaaaggcttggaaacttgatcagacaggaggaggggcgATG

    CV1478 --- CV1479 --- CV1480 Gene: CV1478     GI: 34496933     BI number: CV1478     GOG: -------     Description: conserved hypothetical protein Gene: CV1479     GI: 34496934     BI number: CV1479     GOG: NOG38811     Description: conserved hypothetical protein Gene: CV1480     GI: 34496935     BI number: CV1480     GOG: -------     Description: hypothetical protei            tg           a  a           t  g           a  c            gc            cg           |  c            gc            ta            cg           c  a            at AG        gc A  A       ta G  G       tg TG        tg GC        gc C  T       gt AT       |  g TG        ta TA        at Tg        gc Ta       |  t Gt       |  g |  g      |  t |  g       At T  t       Gc At        Ta         t At        Ta       t  a Cg        Cg       t  t |  a       Gc        gc |  c      |  a       cg Gc       G  c       cg At       A  c       cg Cg       G  a       cg Gc       A  g       cg Cg        At        ta Ta        Gc        gt                         tttttcatcactaacgtacattaagtatcgctcaacccctattcctaacgatcattacgaaaggcttggaaacttgatcagacaggaggaggggcgATG     ..................................................................................................................