                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-19.90 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-13.94 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGATGAGCGACGCGTTGTTCGCATCGCTCAACGGCTGGGTGGACCGCCACTACCGC
GACCGCCTGGCGCCGGAGGACCTGGCCGATCCGCAGCTGCTGATCGAATGCCGCGGCG
CGCTGGACGAGTTGACCGGCATCCTGGGCCTGGGCAGCGTCTATCCCTTCCAGCTGGC
CTGAggcgtttttccaacgcacagcccgtcccgcgaaaccggggcgggttttttcttgtccgcgccatttagcggctgttaacaaattgcttgccgg
ttattccggatgacggactatggtgaaaaTTG

    CV1501 Gene: CV1501     GI: 34496956     BI number: CV1501     GOG: -------     Description: hypothetical protei CC T  C        t A  T      t  c T  T      t  c C  C       ta T  C       ta G  A       gc        aa CG        cg       g  a GC        gc       c  c AT       g  a       gc |  G      A  |       cg CG        Gc        cg GC        Ta        cg GC       C  |       tg GT        Cg        gc |  G       Gc        cg TA        Gc        cg Cg       T  c       cg Cg        Cg        gt Gc        Gt        at                         ttttcttgtccgcgccatttagcggctgttaacaaattgcttgccggttattccggatgacggactatggtgaaaaTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_violaceum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-13.94 kcal/mol Antiterminator: Size=41 nt.     Delta G=-13.90 kcal/mol Anti-antiterminator:   Size=56 nt.     Delta G=-19.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GCTGATGAGCGACGCGTTGTTCGCATCGCTCAACGGCTGGGTGGACCGCCACTACCGC GACCGCCTGGCGCCGGAGGACCTGGCCGATCCGCAGCTGCTGATCGAATGCCGCGGCG CGCTGGACGAGTTGACCGGCATCCTGGGCCTGGGCAGCGTCTATCCCTTCCAGCTGGC CTGAggcgtttttccaacgcacagcccgtcccgcgaaaccggggcgggttttttcttgtccgcgccatttagcggctgttaacaaattgcttgccgg ttattccggatgacggactatggtgaaaaTTG     CV1501 Gene: CV1501     GI: 34496956     BI number: CV1501     GOG: -------     Description: hypothetical protei   T A  G A  C GC CG T  | A  | GC TG CG        AT GC       C  C TG        GC        CC |  C       GT       T  C CG        CG       A  T GC        CG       T  T AT       A  |      C  C CG       G  |      T  C |  G      T  |      G  A |  A       TG        CG GC        GC        GC CG       A  C       AT C  A       GT       |  G T  G       CG        CG AT       A  G       GC GT       G  G       GC CG        GC        GT C  A       TA       |  G GC        CG        TA GC        GC        Cg TG        CG        Cg CG        GT        Gc                         gtttttccaacgcacagcccgtcccgcgaaaccggggcgggttttttcttgtccgcgccatttagcggctgttaacaaattgcttgccggttattccggatgacggactatggtgaaaaTTG     ..................................................................................................................