                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-10.80 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-17.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGGCAAGCGCCGTCGGCAGCCAGTTCGCGCAGATCGCGGCGGATGGAGTCCTCGGAC
ACGCGCAGCACCGCCGCCAGTTCGCCGGCGGAGACCCTGCCGTGCAGccgcagctgctcgcggat
gtagtgatggcggtcggaaggctggctggcgcttgggcgttctctggacatgaggcggactggcgtgaacggaatgccggcatttttgcacgatcccgca
agccaggtcaaagattcggcattttttgtgcaaaaacatgcatgtttgtttgcgtgtttttgcacgatcgtgcattaTTG

    CV1526 Gene: CV1526     GI: 34496981     BI number: CV1526     GOG: COG0561     Description: conserved hypothetical protei ga g  a cg tg gc gt         a |  g      g  c cg       g  a gc       t  t gt        cg t  g       ta a  g       cg gc       t  | tg        tg gc        gc         c at        cg       a  g |  t      g  g      a  g |  g      g  a      g  a |  g      g  c       ta tg       t  t       gt gc        tg        cg tg        cg        gc at        gc        gc gt        cg        tg gc        gt        cg                         catttttgcacgatcccgcaagccaggtcaaagattcggcattttttgtgcaaaaacatgcatgtttgtttgcgtgtttttgcacgatcgtgcattaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0561 Predicted hydrolases of the HAD superfamily ... can be seen here     ..................................................................................................................