                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-20.70 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-14.53 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atcactataaattaacgactcctaatgttgcggcgcacgaaaagtggcaagtctttgattttaattaaccgccatgcagattgtttgccgcggacgggcg
aagggggcatatccgcagacaagtccgcgtctgaacagaattgtcacaaagaattaacgcttgccccgggggtggggcgagggcataattccgccctcgt
aagacagggttcccccttgttttgattgattgtttttgatagtcccgcaaactcgtcccgagcgagattcggctggtcttatatcttcttccacggaggt
GTG

    CV1532 Gene: CV1532     GI: 34496987     BI number: CV1532     GOG: COG4638     Description: probable dioxygenase, alpha subuni gg g  g gt cg cg cg        at cg       a  t gc       t  c tg       a  c ta        cg cg        gc g  |       gc         c c  |       gc       t  c a  |       at       t  c a  |       gc        gc t  |       cg        gc t  |       gt        gt a  |      g  a       at a  |      g  a       cg g  |      g  g       at a  |       ta        gt a  |       gc        at a  |      g  a       at c  |      g  |       tg a  |      g  |      |  a cg       g  |      |  t tg        cg       g  t gc        cg        cg ta        cg        ta                         ttgtttttgatagtcccgcaaactcgtcccgagcgagattcggctggtcttatatcttcttccacggaggtGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [PR] COG4638 Phenylpropionate dioxygenase and related ring-hydroxylating dioxygenases, large terminal subunit ... can be seen here     ..................................................................................................................