                                                                        Gene putatively regulated by attenuation in C_violaceum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-17.30 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-16.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGTGGTGTGGTTCGAGCCGGAATTCATCGAGGCGGAGCAGGCCGCCTACTTCGAAAC
CGCGAAGGAAGACGACGAGATCTGCATCCGCATGCATGAGGGCCGCAAGGCGCTGTGG
ATGGCCGGCGTCAGCGAGGTGGGGCCGTACCAGTCCCCGACCGAGGAAGGCATGCAGC
ACTTCCACGAGTACTATCGGCGTCTGATGGGATCGGCATTGGCTGGCTGAagaggcaagttaa
atgccataatgcagaggcgcgggcattccgcgcctttttttatccttatcttcggccgagatcATG

    CV1533 --- CV1534 --- CV1535 Gene: CV1533     GI: 34496988     BI number: CV1533     GOG: -------     Description: hypothetical protein Gene: CV1534     GI: 34496989     BI number: CV1534     GOG: COG0697     Description: probable membrane protein Gene: CV1535     GI: 34496990     BI number: CV1535     GOG: COG0697     Description: probable membrane protei   a A  g G  a Tg Cg Gc G  a Ta Cg Gt Gt |  a Ta Ta At Cg Gc        ga Gc       a  g        a C  |       cg       c  t Ta        gc       g  t At        tg        gc G  a      a  c       gc G  a      a  g       cg G  t      t  |       gc T  g      a  |       cg A  |       cg        gc Gc        cg        gc Ta        gc        at Cg        ta        gt Ta        at        at                         ttttatccttatcttcggccgagatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here     ..................................................................................................................