                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-18.70 kcal/mol
Antiterminator: Size=64 nt.     Delta G=-13.59 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-11.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCAAAGCGCCGATGGTACTGCAGGGGCAGCCCTGTGGGAGAGTAGGTCATTGCCGGG
TaatGGATCTTTAGCTCAGTTGGTTAGAGCAACCGGCTCATAACCGGTCGGTCCGGGGT
TCGAGTCCCTGAAGGTCCAccatGGGGGATTAGCTCAGCTGGGAGAGCACCTGCCTTGC
ACGCAGGGGGTCAAGAGTTCGAATCTCTTATTCTCCAccataaaaaagatagcagataaaactgctatctttt
ttattttattcattatataattttaagtaaatataaagaggaggagatacaTTG

    CAC0008 Gene: CAC0008     GI: 15893306     BI number: CAC0008     GOG: NOG14708     Description: Predicted HD superfamily hydrolas             G           C  A           T  A           T  T            GC            AT            GC            AT            AT           C  A           T  T            GT            GC            GT CC        GC A  T       GC CG       |  A       aa GC       |  c      t  a A  |      A  c      a  a GC       C  a       gc AT       G  t       at GT       C  a       cg G  G      A  a       gc GC       C  a       at TA       G  a       ta |  C       Ta        at CG        Ta        gc GC        Cg        at |  A      |  a       at |  G      |  t       at A  G      |  a       at CG        Cg        at TG        Gc        at CG        Ta        ta GT        Cg        at                         tttattcattatataattttaagtaaatataaagaggaggagatacaTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-11.80 kcal/mol Antiterminator: Size=64 nt.     Delta G=-13.59 kcal/mol Anti-antiterminator:   Size=31 nt.     Delta G= -4.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ACCAAAGCGCCGATGGTACTGCAGGGGCAGCCCTGTGGGAGAGTAGGTCATTGCCGGG TaatGGATCTTTAGCTCAGTTGGTTAGAGCAACCGGCTCATAACCGGTCGGTCCGGGGT TCGAGTCCCTGAAGGTCCAccatGGGGGATTAGCTCAGCTGGGAGAGCACCTGCCTTGC ACGCAGGGGGTCAAGAGTTCGAATCTCTTATTCTCCAccataaaaaagatagcagataaaactgctatctttt ttattttattcattatataattttaagtaaatataaagaggaggagatacaTTG     CAC0008 Gene: CAC0008     GI: 15893306     BI number: CAC0008     GOG: NOG14708     Description: Predicted HD superfamily hydrolas             c           c  a           A  t           C  a            Ca            Ta            Ca            Ta            Ta           A  g           T  a            Tt            Ca            Tg            Cc            Ta           |  g           |  a           A  t   T       A  a A  C      G  a AT       C GC       T C  T      T         aa T  T      G        t  a TA        A       a  a GT        G        gc AT        A        at GC       |         cg AT       |         gc A  C      |         at C  C       A        ta TA        C        at Gc        T        gc Gc        G        at                         tttttattttattcattatataattttaagtaaatataaagaggaggagatacaTTG     ..................................................................................................................