                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:60 nt.    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-12.20 kcal/mol
Antiterminator:    Distance from promoter:22 nt. Size=55 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -3.34 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATG-CAAAAT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATGCTCAAAAGAATGGCGATTGGTCAAAATATGGTGATTATATAAATAAACTAGG
TAAGACTTTAGATGAATTGAATAAATAGatttttaaattataggttatattttgtagcctataatttttttaatccatt
tatttgtttaaattatgcttttgtgtaaataataacaaataagtggaggaaaaaaATG

    CAC0011 --- CAC0012 --- CAC0013 Gene: CAC0011     GI: 15893309     BI number: CAC0011     GOG: COG1376     Description: Uncharacterized conserved of ErfK family Gene: CAC0012     GI: 15893310     BI number: CAC0012     GOG: COG0579     Description: Predicted dehydrogenase with iron-sulfur domain Gene: CAC0013     GI: 15893311     BI number: CAC0013     GOG: COG3862     Description: Uncharacterized small conserved protein, ortholog of T.maritima (4981999) and P.abyssi (5457704            TA           A  G           A  a           A  t           T  t            At            At            Gt AT        Ta T  A       Ta A  A      A  a T  A       At T  T       Gt A  A       Ta         t G  A       At       t  t TA       G  |      a  t GC       A  |       tg GT       T  |       at TA        Ta        ta A  G       Tg        tg T  G       Cg        gc A  T       At        gc A  A       Gt        at A  A      A  a       ta A  |       At        at CG        Ta        ta TA        Gt        ta GC        Gt        at GT        At        at                         tttttaatccatttatttgtttaaattatgcttttgtgtaaataataacaaataagtggaggaaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1376 Uncharacterized protein conserved in bacteria ... can be seen here [R] COG0579 Predicted dehydrogenase ... can be seen here [S] COG3862 Uncharacterized protein with conserved CXXC pairs ... can be seen here     ..................................................................................................................