                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:31 nt.    Distance to gene:153 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-17.60 kcal/mol
Antiterminator:    Distance from promoter:18 nt. Size=27 nt.     Delta G= -5.01 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtgt-gataat. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaacgcg is shown in italic-bold style

ttgtgtcgttaaatttcaattaagataatcattttaaatgattaattagggtggtaacgcggtctttcgtcccttacgtaaggggattgagaggcttttt
ttattgtcaaaattaagaattttaaacttcagaagagtaactgataaggattttttttccgtaattatcatttgcttatttttataaccttttttcagaa
aaataatacaaaaaagtaaatattttaatacatatacaaaataagggggcattcatATG

    CAC0014 --- serA Gene: CAC0014     GI: 15893312     BI number: CAC0014     GOG: COG0075     Description: Aminotransferase Gene: serA     GI: 15893313     BI number: CAC0015     GOG: COG0111     Description: D-3-phosphoglycerate dehydrogenas   t t  a ta ta at cg ta at at ta a  a g  |                  g at                 c  t at        ct       a  a ta       t  t       ta tg        gt        tg |  g       gc        cg a  g       cg        cg at        gt        cg cg       c  |       ta tg       a  |      |  t t  |      a  |       gt t  |      t  |       cg a  |      g  |       ta a  |      g  |       tg at       t  |       ta ta        gc        cg ta        gc        tg gc        gc        gc cg        at        gt                         ttttttattgtcaaaattaagaattttaaacttcagaagagtaactgataaggattttttttccgtaattatcatttgcttatttttataaccttttttcagaaaaataatacaaaaaagtaaatattttaatacatatacaaaataagggggcattcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0075 Serine-pyruvate aminotransferase/archaeal aspartate aminotransferase ... can be seen here [HE] COG0111 Phosphoglycerate dehydrogenase and related dehydrogenases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................