                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:184 nt.    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-10.90 kcal/mol
Antiterminator:    Distance from promoter:159 nt. Size=35 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttatcc-gataat. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttatccttgaaaagtatacaaaggataataagagaacagaaaaatagtgattaatattatatatgagtcaatacagttttattactgcattggctcattt
ttagttattaaatatatgtaaggtttagttttatgtacttagatgatactatttgaatataaaatatttacttagggggtaatatgatgaaaaatatttg
tgacaatccacctgttatttttcctattagattttaataggaaggagtaatttttATG

    CAC0055 Gene: CAC0055     GI: 15893352     BI number: CAC0055     GOG: COG4332     Description: Uncharacterized predicted metal-binding protein, ortholog of Streptomyces (2808777             t           a  t aa        gt c  t       at a  c       ta gc        ta ta        at gc        ta |  c       cg t  t       cg t  g       ta t  t       ta at       |  g ta        tg at        ta at        tg at        at at        ta at        ta gc        gt             ttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4332 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................