Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:206 nt.    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-11.70 kcal/mol
Antiterminator:    Distance from promoter:194 nt. Size=24 nt.     Delta G= -3.40 kcal/mol
Anti-antiterminator:    Distance from promoter:142 nt.    Size=64 nt.     Delta G= -3.72 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGACA-TACAAT. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGACATGTCTCAGATAACAGATTTTACAATAAAGCCAAAGGATAATTTGGTTATCCA
AAACCATACTAGTTTCATAATTGATGTAAATACAAAAGAAATAATGATGAAGCAGCAG
CAAAATAATTATAAAGTAGTTTCTAGTAGTTAGagtataaatttcaagtgtgaaagaattgcagaaaaataacaat
aaattaaggttttgatgaaaagagttttttaaatgttaaggtaataggactatggcaaaccatggttctttttttatattaaaattggaggagatagagA
TG

    CAC0065


Gene: CAC0065     GI: 15893362     BI number: CAC0065     GOG: -------     Description: Hypothetical protei


 tg
a  a
g  a
 ta
 ta
 tg
 ta
g  g
 gt
 at
 at
t  t
t  t
a  t
a  a
a  a
t  a
a  |
 at
 cg
 at
 at
 ta
a  a       ta        aa
a  g      a  g      c  a
a  |      a  g       gc
a  |       ta        gc
a  |       gc        ta
g  |       gt        at
a  |      a  a       tg
 cg        at        cg
 gt        tg        at
 ta        tg        gt
 ta        gc        gc
 at        ta        at
                        ttttttatattaaaattggaggagatagagATG
    ..................................................................................................................