                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.30 kcal/mol
Antiterminator: Size=67 nt.     Delta G= -4.04 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACAGAGCAGTTAGCCAAAGAAATGGTGGAAGAAAAGTGGAATTCTTTAGATAAGCAG
AATAAAACTCTTCAGTATGTGAGTGAACAGTTACAGAAGGTAGGTATTCAAATTTCAC
AGGAGGATATTTGCAATATAATAAAAGCTACGGTAGGACATATGAACATTAATAATCA
CTAAaaatagcaggatgaatatttttcattctgctattttgtattaaggtaacagaattaattaaggcacaaggaaatgttataataggtattgaaa
tatttataagattaaagaggatttaggatATG

    CAC0066 --- CAC0067 --- CAC0068 Gene: CAC0066     GI: 15893363     BI number: CAC0066     GOG: COG1136     Description: ABC transporter, ATP-binding protein Gene: CAC0067     GI: 15893364     BI number: CAC0067     GOG: COG0577     Description: (FS) similar to ABC transporter (permease), YXDM B.subtilis ortholog Gene: CAC0068     GI: 15893365     BI number: CAC0068     GOG: COG0577     Description: (FS) similar to ABC transporter (permease), YXDM B.subtilis ortholo CA A  T A  T G  A TA AT TA A  A C  | AT GC |  A GC AT TA |  A G  a G  a C  a At Ta         t Cg       a  t Gc       t  t A  a       at A  g       at A  g       gc A  a       ta T  t       at A  g       gt A  a       gc Ta        at At        cg Ta        gc At        at At        ta             ttttgtattaaggtaacagaattaattaaggcacaaggaaatgttataataggtattgaaatatttataagattaaagaggatttaggatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1136 ABC-type antimicrobial peptide transport system, ATPase component ... can be seen here [V] COG0577 ABC-type antimicrobial peptide transport system, permease component ... can be seen here [V] COG0577 ABC-type antimicrobial peptide transport system, permease component ... can be seen here     ..................................................................................................................