Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:102 nt.    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -8.80 kcal/mol
Antiterminator:    Distance from promoter:57 nt. Size=54 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-tatcat. It has a score value of 87.01 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgataaaatgaagttttaatgttatcattaaagtaattgaggtacatacctagatttgcctaggagactctctctcatatatttttgctaacttacttg
acataggtcaggagattatataacatattgtggattggtatagtgccaatctttttgttttataaaaaagttttttttatagtaatttattttattgcat
atatagttattaggattcaggaggataaaaATG

    CAC0084


Gene: CAC0084     GI: 15893380     BI number: CAC0084     GOG: COG0494     Description: MutT/Nudix family hydrolas


 ta
a  g
 cg
 at
 gc
 ta
 tg
 cg
|  a
|  g
|  a
|  t
|  t
|  a
|  t
|  a
|  t
|  a
|  a
|  c
|  a
|  t
|  a
|  t
|  t
a  g        a
t  t      t  g
 tg       a  t
 cg        tg
|  a       gc
 at        gc
 at        ta
 tg        ta
 cg        at
 gt        gc
 ta        gt
            ttttgttttataaaaaagttttttttatagtaatttattttattgcatatatagttattaggattcaggaggataaaaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here

    ..................................................................................................................