                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:40 nt.    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-18.70 kcal/mol
Antiterminator:    Distance from promoter:29 nt. Size=30 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-aaaaat. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaacatcacttatatccgtaaaaattattcattaaaaaattttaactaagatgctattgtaataataaagctattgttatattatatatataacaat
agctttatttattgaaattaaggaaaaattaagaaataagtaaatattactttatctttatggtttattatatattttggttgatgaagtgatatttcat
gtataagaaataaggaggttaaagcATG

    CAC0138 --- CAC0139 --- CAC0140 --- CAC0141 Gene: CAC0138     GI: 15893433     BI number: CAC0138     GOG: COG1131     Description: ABC transporter, ATP-binding component Gene: CAC0139     GI: 15893434     BI number: CAC0139     GOG: COG1277     Description: Predicted permease Gene: CAC0140     GI: 15893435     BI number: CAC0140     GOG: COG1277     Description: Predicted permease Gene: CAC0141     GI: 15893436     BI number: CAC0141     GOG: COG0845     Description: Membrane permease, predicted cation efflux pump             t           a  a           t  t            ta            at ag        ta a  c       at at        ta ta        ta at        gc at        ta tg        ta at        at at        ta ta        cg gt        gc ta        at t  t       at at        at ta        ta             tttattgaaattaaggaaaaattaagaaataagtaaatattactttatctttatggtttattatatattttggttgatgaagtgatatttcatgtataagaaataaggaggttaaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1131 ABC-type multidrug transport system, ATPase component ... can be seen here [R] COG1277 ABC-type transport system involved in multi-copper enzyme maturation, permease component ... can be seen here [R] COG1277 ABC-type transport system involved in multi-copper enzyme maturation, permease component ... can be seen here [M] COG0845 Membrane-fusion protein ... can be seen here     ..................................................................................................................