                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-15.41 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aagtacaaagtacttttgaaaactaaataaattaaTCCGGTGACTATAGCTTGGTTGTAACACCCGTTCCCAT
ACCGAACACGAAGGTTAAGAACCAAAGCGCCGATGGTACTGCAGGGGCAGCCCTGTGG
GAGAGTAGGTCATTGCCGGGTaatttGGTTTATTAGCTCAGTTGGTAGAGCACATGACTT
TTAATCATGGTGTCCGGGGTTCGACTCCCCGATAAGCCAccataaacgctttgaaatttaattttaaagcg
tttttttacatatttattttacgataggagaagaatatATG

    CAC0153 Gene: CAC0153     GI: 15893448     BI number: CAC0153     GOG: COG0637     Description: Beta-phosphoglucomutase, putativ             G           C  A           T  C           T  T            GC            GC            GC            GC            CG           |  A           |  T           |  A           |  A           C  G           T  C   T        GC T  T       TA T  A       Gc C  A       Gc AT        Ta GC        At TA       C  a AT       T  a CG       A  a A  |      A  c CG       T  | GT       T  | A  G      T  | G  T      T  |        t A  |      C  |      t  a T  |      A  |       ta GC       G  |       at GC       T  |       at T  G      A  |       at T  |      C  |       gt G  |      A  |       ta A  |       Cg        ta CG        Gc        ta TG        At        cg CG        Gt        gc GT        At        cg AT        Tg        at                         ttttttacatatttattttacgataggagaagaatatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0637 Predicted phosphatase/phosphohexomutase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-11.30 kcal/mol Antiterminator: Size=68 nt.     Delta G=-15.41 kcal/mol Anti-antiterminator:   Size=37 nt.     Delta G=-13.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case aagtacaaagtacttttgaaaactaaataaattaaTCCGGTGACTATAGCTTGGTTGTAACACCCGTTCCCAT ACCGAACACGAAGGTTAAGAACCAAAGCGCCGATGGTACTGCAGGGGCAGCCCTGTGG GAGAGTAGGTCATTGCCGGGTaatttGGTTTATTAGCTCAGTTGGTAGAGCACATGACTT TTAATCATGGTGTCCGGGGTTCGACTCCCCGATAAGCCAccataaacgctttgaaatttaattttaaagcg tttttttacatatttattttacgataggagaagaatatATG     CAC0153 Gene: CAC0153     GI: 15893448     BI number: CAC0153     GOG: COG0637     Description: Beta-phosphoglucomutase, putativ             c           g  t           c  t           a  t            ag            aa            ta            aa            ct           |  t           |  t           |  a           |  a           c           A            C            C            G            A            A            T   G       A C  A      G   T  C      C   T  T      C   GC       C  | GC       C  | GC       T  |        t GC       C  |      t  a CG       A  |       ta |  A      G  |       at |  T      C  |       at |  A      T  |       at |  A      T  |       gt C  G      G  |       ta T  C      G  |       ta GC        G        ta TA        G        cg Gc        C        gc Gc        C        cg Ta        T        at At        G        at                         tttttacatatttattttacgataggagaagaatatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0637 Predicted phosphatase/phosphohexomutase ... can be seen here     ..................................................................................................................