                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:85 nt.    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-20.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTGAAA-TAGAAT. It has a score value of 68.27 and is shown in blue

CTGAAAAATTAGGACATAATATAACTATAGAATCTAAGTATAATGAAGGAACAAAGCT
TTACATACACTTCCCTAAATGGTGTGATTATTATGATGTTACAAAAATGTAAggttaaaaa
gcaaaatgtaagccagaaaaatggctgtacattttgcttttttatataatttacatataggaaacgaatattacttataacggaggtagaagaATG

    CAC0226 --- CAC0227 Gene: CAC0226     GI: 15893518     BI number: CAC0226     GOG: COG1136     Description: ABC transporter, ATP-binding protein Gene: CAC0227     GI: 15893519     BI number: CAC0227     GOG: COG0577     Description: Predicted permeas           aa          a  a          g  a           at           cg           cg           gc           at          |  g           at           ta           gc           ta           at           at           at           at           cg           gc           at             tttttatataatttacatataggaaacgaatattacttataacggaggtagaagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1136 ABC-type antimicrobial peptide transport system, ATPase component ... can be seen here [V] COG0577 ABC-type antimicrobial peptide transport system, permease component ... can be seen here     ..................................................................................................................