Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:153 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-18.80 kcal/mol

                                                                        Nomenclature/Definitions

GACATAGATGACAATATATTCTTATCGAAAGAAATACAAAAAGAGAGTGGTTTTGTGG
GACCTAAGGCAATAGAAATGAGCAATGTAGTAATAGCAGGTGAATGAtggataaaaagtaccagc
ctaattaatggctggtacttttttatgacagcatgtgtgtttgtgttcatatatgctttaatgtgaaatttttttaaaaaaatgtattgacaatatgctt
gaatccgtttacaatataatcaaacaaacaaatataaacacaagcactcgcaaatgaatatatgaaaggtgatttatATG

    CAC0231 --- fruB --- CAC0233


Gene: CAC0231     GI: 15893523     BI number: CAC0231     GOG: COG1349     Description: Transcripcional regulator of sugar metabolism
Gene: fruB     GI: 15893524     BI number: CAC0232     GOG: COG1105     Description: 1-phosphofructokinase (fructoso 1-phosphate kinase)
Gene: CAC0233     GI: 15893525     BI number: CAC0233     GOG: COG1762     Description: PTS system, IIA componen


          tt
         a  a
         a  a
         t  t
          cg
          cg
          gc
          at
          cg
          cg
          at
          ta
          gc
          at
          at
            ttttatgacagcatgtgtgtttgtgttcatatatgctttaatgtgaaatttttttaaaaaaatgtattgacaatatgcttgaatccgtttacaatataatcaaacaaacaaatataaacacaagcactcgcaaatgaatatatgaaaggtgatttatATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[KG] COG1349 Transcriptional regulators of sugar metabolism ... can be seen here
[G] COG1105 Fructose-1-phosphate kinase and related fructose-6-phosphate kinase (PfkB) ... can be seen here
[GT] COG1762 Phosphotransferase system mannitol/fructose-specific IIA domain (Ntr-type) ... can be seen here

    ..................................................................................................................