                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-14.40 kcal/mol
Antiterminator: Size=77 nt.     Delta G=-10.90 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGAAATTGCTTCAAAGCTTTATTTAAGCGAAGGGACTGTAAGAAATTACATTACTAG
TTTGCTTGAAAAGCTTGAGCTTAGGGATAGAACACAACTTGCAATATTTTATTTAAAG
AATAGTTGAttttgtaaaaggagcttcgttaaattgcgatgctccttttattcatttatagatatgacaaatgtcattatgatttatgaacaaa
tgcactattttaggtatgtaaaatctaatatcatatgagtatagaaggaaggaacttgaacgaagaaatttaagtttggaggaattgtagATG

    CAC0241 --- CAC0242 --- CAC0243 Gene: CAC0241     GI: 15893533     BI number: CAC0241     GOG: COG1131     Description: ABC-type multidrug transport system, ATP-ase compoment Gene: CAC0242     GI: 15893534     BI number: CAC0242     GOG: COG0842     Description: Predicted permease Gene: CAC0243     GI: 15893535     BI number: CAC0243     GOG: COG0842     Description: Predicted permeas            TT           T  A           A  A            TA            TG            TA            TA            AT           T  |           A  |           A  |           C  |           G  |           T  |            TA            CG            AT            AT            CG           A  A           C  |            At            At            Gt TG        At T  A       Tg CG        At GC       |  a AT       G  a AT       G  a       aa A  A      G  a      a  t A  |      A  g      t  t G  |       Tg        tg TG        Ta        gc TG        Cg        cg CG        Gc        ta |  A       At       t  t |  T       Gt        cg G  A      T  c       gc TG       T  |       at TA        Cg        gc TA        Gt        gc GC        At        at                         tttattcatttatagatatgacaaatgtcattatgatttatgaacaaatgcactattttaggtatgtaaaatctaatatcatatgagtatagaaggaaggaacttgaacgaagaaatttaagtttggaggaattgtagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1131 ABC-type multidrug transport system, ATPase component ... can be seen here [V] COG0842 ABC-type multidrug transport system, permease component ... can be seen here [V] COG0842 ABC-type multidrug transport system, permease component ... can be seen here     ..................................................................................................................