                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:142 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=53 nt.     Delta G= -7.22 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGATGTAGCATTTATATCAGAAGGCAAGAATGTATTAAGCGGAAATGCTGATGAATT
AAGAAATGAAAAAGGAACTTCAATAGATGGGCTCTATAGAGAAATTTTTAAAGATTTC
TAAataacattaaatctgcataatataaaatgcagatttttttaaacaaatattgataaagattatcaaatgatatataatattgttagttaataaat
taacaaagttttatattttaaatacaatgttgcataagacaaggtaattgaactaatactatactagtaattggaggggataatatATG

    CAC0267 Gene: CAC0267     GI: 15893559     BI number: CAC0267     GOG: COG0039     Description: L-lactate dehydrogenas            TA           T  A            TA            TG            TA            AT   G        AT G  G       AT T  C       GC AT        AT GC       G  A AT       A  A TA        Ta AT        At A  A       Ta        at CG       |  a      t  a TA       C  c      a  a TG       T  a      a  a C  A      C  t       ta A  A      G  t       at A  A      G  a       cg G  |      G  a       gc GT        Ta        ta AT        At        cg AT        Gc        ta AT        At        at AT        Tg        at                         tttttaaacaaatattgataaagattatcaaatgatatataatattgttagttaataaattaacaaagttttatattttaaatacaatgttgcataagacaaggtaattgaactaatactatactagtaattggaggggataatatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0039 Malate/lactate dehydrogenases ... can be seen here     ..................................................................................................................