                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-17.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGAA-TATTAT. It has a score value of 63.59 and is shown in blue

TTGGAATTAACGGAGTGAAGGATATTATAGAGGTTCCTTTAAATGATGAAGAGAAAAA
TAATCTTACAGATTCCGCAAAAACATTAAAGGAATCACTAGATAGTATATTTTAAggta
aaagacctaaactccaagggtggaggctaggtctttttttattttattgttgaaatttaattagctTTG

    CAC0268 --- CAC0269 Gene: CAC0268     GI: 15893560     BI number: CAC0268     GOG: COG1131     Description: ABC transporter ATP-binding protein Gene: CAC0269     GI: 15893561     BI number: CAC0269     GOG: NOG28580     Description: Uncharacterized membrane protei           gg          a  g           at           cg           cg           ta           cg          a  g          a  c           at           ta           cg           cg           at           gc           at             ttttttattttattgttgaaatttaattagctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1131 ABC-type multidrug transport system, ATPase component ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:90 nt.    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-18.40 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGGAA-TATTAT. It has a score value of 63.59 and is shown in blue TTGGAATTAACGGAGTGAAGGATATTATAGAGGTTCCTTTAAATGATGAAGAGAAAAA TAATCTTACAGATTCCGCAAAAACATTAAAGGAATCACTAGATAGTATATTTTAAggta aaagacctaaactccaagggtggaggctaggtctttttttattttattgttgaaatttaattagctTTG     CAC0268 --- CAC0269 Gene: CAC0268     GI: 15893560     BI number: CAC0268     GOG: COG1131     Description: ABC transporter ATP-binding protein Gene: CAC0269     GI: 15893561     BI number: CAC0269     GOG: NOG28580     Description: Uncharacterized membrane protei           gg          a  g           at           cg           cg           ta           cg          a  g          a  c           at           ta           cg           cg           at           gc           at           at             tttttattttattgttgaaatttaattagctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1131 ABC-type multidrug transport system, ATPase component ... can be seen here     ..................................................................................................................