                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -5.81 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -7.56 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agagtggtaccgcg is shown in italic-bold style

gaacagaaatattaagaatcaaataaacttccagagagtcgggattgctgggaaccgatagtttttagattttgaactcatctgtgagcagtcgcctgaa
gttactgtagggtagaacggaattccaccgttatatggatagatagtacgaaccatttatagtggagtgctattgaaaaagtgaactttaagttaagtta
aatagagtggtaccgcgagtaaacctcgtctctttcgtattgatggagacgaggttttttatttattaagaaaataaacatttaaaggagtgttttttat
ATG

    CAC0273 Gene: CAC0273     GI: 15893565     BI number: CAC0273     GOG: COG0119     Description: 2-isopropylmalate synthas ag a  t t  t ta ta cg at         a at       a  a        a g  a      t  c      t  t t  a       gc       g  t g  a       at        cg a  t       gc        ta a  a       cg       t  t a  g       gt        tg a  |      c  |       cg a  |      c  |       ta g  |      a  |       cg ta       t  |       ta tg       g  |       gc at       g  |       cg tg       t  |       ta cg        gc        cg gt        at        cg ta        gc        at gc        at        at                         ttttatttattaagaaaataaacatttaaaggagtgttttttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0119 Isopropylmalate/homocitrate/citramalate synthases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-17.60 kcal/mol Antiterminator: Size=30 nt.     Delta G= -5.81 kcal/mol Anti-antiterminator:   Size=44 nt.     Delta G= -5.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case The T-box sequence: agagtggtaccgcg is shown in italic-bold style gaacagaaatattaagaatcaaataaacttccagagagtcgggattgctgggaaccgatagtttttagattttgaactcatctgtgagcagtcgcctgaa gttactgtagggtagaacggaattccaccgttatatggatagatagtacgaaccatttatagtggagtgctattgaaaaagtgaactttaagttaagtta aatagagtggtaccgcgagtaaacctcgtctctttcgtattgatggagacgaggttttttatttattaagaaaataaacatttaaaggagtgttttttat ATG     CAC0273 Gene: CAC0273     GI: 15893565     BI number: CAC0273     GOG: COG0119     Description: 2-isopropylmalate synthas   a a  a g  a ta tg         g at       t  g tg       g  t c  a       aa         a g  |       gc       t  t ta        ac       g  t gc        tg        cg at        ac        ta gt       a  |      t  t gt       a  |       tg ta       t  |       cg g  a      t  |       ta a  g      g  |       cg t  t      a  |       ta at       a  |       gc ta        tg        cg ta        ta        ta tg        gg        cg at        at        cg                         ttttttatttattaagaaaataaacatttaaaggagtgttttttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0119 Isopropylmalate/homocitrate/citramalate synthases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................