                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:188 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGAAAATAGGCTTCATTCAATAAAAGCTATTATGGTTGCAACATTAGGTGATATATA
Ggtatgtttttataaatgagacaatgagctgtatgaaaaatcagctcatttttttgcgctaatttcagcagaaatatataataaaagctcaaactatcgc
aaacaatactggaaactagtatatagtaagattattaatttatataatttttatatataatttattcacaattaagaatgggatagtaacatataattac
gatatgagattttttaaaatagaattaaggaggtggcatggaTTG

    CAC0317 --- CAC0318 --- CAC0319 --- CAC0320 Gene: CAC0317     GI: 15893609     BI number: CAC0317     GOG: COG0642     Description: Sensory transduction histidine kinase Gene: CAC0318     GI: 15893610     BI number: CAC0318     GOG: COG0845     Description: Membrane permease, predicted cation efflux pumps Gene: CAC0319     GI: 15893611     BI number: CAC0319     GOG: COG1136     Description: ABC transporter ATP-binding protein Gene: CAC0320     GI: 15893612     BI number: CAC0320     GOG: COG0577     Description: Predicted permeas AT C  T A  A A  G CG GT         a TG       t  a TA       a  a GT       t  t |  A       tg GT        ta TA        tg AT        ta         a TA        gc       a  a TG       |  a      g  a |  g       ta        ta |  t       at        at A  a       tg       t  | T  t      |  a       gc Cg       g  g       ta Gt        Gc        cg At        At        gc At        Tg        at At        At        gc At        Ta        ta Ta        At        at At        Tg        at                         tttttgcgctaatttcagcagaaatatataataaaagctcaaactatcgcaaacaatactggaaactagtatatagtaagattattaatttatataatttttatatataatttattcacaattaagaatgggatagtaacatataattacgatatgagattttttaaaatagaattaaggaggtggcatggaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0642 Signal transduction histidine kinase ... can be seen here [M] COG0845 Membrane-fusion protein ... can be seen here [V] COG1136 ABC-type antimicrobial peptide transport system, ATPase component ... can be seen here [V] COG0577 ABC-type antimicrobial peptide transport system, permease component ... can be seen here     ..................................................................................................................