Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:50 nt.    Distance to gene:156 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.60 kcal/mol
Antiterminator:    Distance from promoter:16 nt. Size=72 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:    Distance from promoter:3 nt.    Size=49 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaaaa-tacact. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaaaactagagggcttgataaaacttacacttattcaaaaagtatcgtttgatttatcatatttaaaatacagttgcttttgaactagagataagatta
tcctctagttttttttattttatttatatagttatctttatattatatcgaattgtatgttacaatataatataggtaaaaaatagaatttacatatagg
ccttaccaacacaggctaaatatacataagataaaaaatataatatgatacaattgattgagagggattaaaATG

    CAC0323


Gene: CAC0323     GI: 15893615     BI number: CAC0323     GOG: COG0642     Description: Sensory transduction histidine kinas


           ac
          a  t
          g  a
          t  g
          t  a
           tg
           ta
           ct
           ga
          |  a
           tg
           ta
 ta        gt
a  t      a
c  t      c  |
t  t      a  |
a  a      t  |
 ta        a
 ta        a
 ta        a
 at       a  |
|  a       t
 gc        t
 ta        t
 tg        a        ga
t  t       t       a  t
g  |       a        at
c  |       c        ta
t  |      t         at
 at       a        |  c
 tg        t        gc
 gc        t        at
a  |      |         gc
 at       t         at
 at       a         ta
 at        g        cg
 at        t        at
 cg        t        at
 ta        t        gt
                        tttttattttatttatatagttatctttatattatatcgaattgtatgttacaatataatataggtaaaaaatagaatttacatataggccttaccaacacaggctaaatatacataagataaaaaatataatatgatacaattgattgagagggattaaaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[T] COG0642 Signal transduction histidine kinase ... can be seen here

    ..................................................................................................................