Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:99 nt.    Distance to gene:83 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-16.20 kcal/mol
Antiterminator:    Distance from promoter:66 nt. Size=40 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:    Distance from promoter:10 nt.    Size=71 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ATGATA-TAAaat. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGATAACAATGGGAAAAGTGGCAAAATAAaattatggatgggattacaaagaactacttaatagcagtaattttgat
aaaaaattattaaagaatatacttcataattgtaataatgcagtgaaaagatgaaatgaagcggctgaatttaagtaagctgcttcattattttttagta
actcctcaagtataagcgtttataaaggatttcctagataattagaacaggcatttgtgcagagagagataccgtaaaGTG

    CAC0345


Gene: CAC0345     GI: 15893636     BI number: CAC0345     GOG: -------     Description: Hypothetical protei


  t
a  a
g  a
 ta
 ta
 ta
 ta
 at
 at
 ta
 gt
 at
c  a
g  a       ta
a  a      a  a
t  g       at
a  a       tg
a  a       gc
t  t       ta
t  a       tg
c  t       at         t
a  a      |  g      t  a
t  c      |  a      t  a
c  |      |  a      a  g
 at       |  a      a  t
 at       |  a      g  a
 gc       |  g       ta
|  a      |  a       cg
|  t      |  t       gc
|  a      |  g       gt
a  a      |  a       cg
 at       a  a       gc
 at        ta        at
 cg        at        at
 at        cg        gc
 ta        ta        ta
 ta        ta        at
 at        cg        at
                        attttttagtaactcctcaagtataagcgtttataaaggatttcctagataattagaacaggcatttgtgcagagagagataccgtaaaGTG


    ..................................................................................................................