                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:188 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-13.70 kcal/mol
Antiterminator: Size=77 nt.     Delta G=-13.10 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACAATACTTACACTTATAATAGTTCCAGTAATGTATAGTGTTCTTGAAAGAGATTAA
tctaaattaatttttaatattgaaacagcaggctgtagctaatagcctgctgttttgatttgtataattatagtaaggataatgaaactaaatttttaaa
cacaaatatttctatatgtttattgggaaaatagaaatatacattaaaaaatcaaatgaaatatatgctaaaaacttgtttgagtatataatagagacaa
taaagatcatattcattataagaactgcaattggaggaagctATG

    CAC0371 --- CAC0372 Gene: CAC0371     GI: 15893662     BI number: CAC0371     GOG: COG0745     Description: Response regulator (CheY-like domain and HTH domain) Gene: CAC0372     GI: 15893663     BI number: CAC0372     GOG: COG0642     Description: Sensory transduction histidine kinase (HisKA and HATPase damains            ta           c  a            ta            At            At            Ta            Ta            At            Gt            At            Gt            At           A  |           A  |           G  |           T  |           T  |           C  |            Ta            Ta            Gt   A        Ta C  G       Gt C  T       At TA        Tg TA       |  a GT       A  a A  G       Ta GT        Gc TA        Ta AT       |  g tA       |  c        c cG       A  a      g  t gT       A  g      a  a a  G       Tg        ta aT        Gc        gt gT        At        ta gC        Cg        cg aT       C  t       gc gT        Ta        gc g  G       Tg        at tA        Gc        cg tA        At        gc                         tgttttgatttgtataattatagtaaggataatgaaactaaatttttaaacacaaatatttctatatgtttattgggaaaatagaaatatacattaaaaaatcaaatgaaatatatgctaaaaacttgtttgagtatataatagagacaataaagatcatattcattataagaactgcaattggaggaagctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here [T] COG0642 Signal transduction histidine kinase ... can be seen here     ..................................................................................................................