Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:69 nt.    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -8.30 kcal/mol
Antiterminator:    Distance from promoter:23 nt. Size=59 nt.     Delta G= -4.25 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTATT-TAGATT. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTATTTGTACAACAAGTATCTAGTAGATTTTTCAGATAATGAATTGTGCTATATTAC
AAATTTCTTTTTGAATTCACCAGCTTCTTAAaaattaaaaagatcatttataattatgtcatatataaatgatcttt
ttactatccaaaagtatcaaacttctaattgcatttgcatcgtgttagtattaaacttattataggtaaattattgaacttaATG

    CAC0381


Gene: CAC0381     GI: 15893672     BI number: CAC0381     GOG: COG0840     Description: Methyl-accepting chemotaxis protei


           CT
          G  T
          A  C
          C  T
 AT       C  T
T  A      A  A
C  T      C  A
 GT       T  a
 TA       T  a
 GC       A  a
 TA        At
 TA        Gt
A  A       Ta
 AT        Ta         g
 GT        Ta       t  t
T  T       Ta       a  c
A  C       Ta       t  a
A  T       Cg       t  t
T  T       Ta       a  a
 AT       |  t       at
 GT       T  c       ta
 AT        Ta        at
 CG        At        ta
 TA        At        ta
 TA        At        ta
T  T      C  a       at
T  |       At        cg
T  |       Ta        ta
 AT        Ta        at
 GC        At        gc
                        tttttactatccaaaagtatcaaacttctaattgcatttgcatcgtgttagtattaaacttattataggtaaattattgaacttaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here

    ..................................................................................................................