                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:133 nt.    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-17.70 kcal/mol
Antiterminator:    Distance from promoter:118 nt. Size=32 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTGAAA-TAAaat. It has a score value of 76.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGAAAGAACAACAATTGAATCATAAaatagctgcataaaaaattaaatagttacaaactgagtaaaactaattattaatt
aaaaaaaggatgtatgtgtaatgttaataatgtagtaagatgcaacaaaattgagaattaaatatatatcagaggaataatgaaggttaacgctgataaa
aaggcgttagcctttttttatgcataaaacaatgtccacagttagtaagagattcaATG

    CAC0401 Gene: CAC0401     GI: 15893692     BI number: CAC0401     GOG: -------     Description: Hypothetical protein, CF-24 famil   g        aa t  a      t  a a  a      a  a a  g      g  a tg        tg at        cg at        gc |  a       cg g  a       at g  c       at a  g       ta gc        tg at        gc cg        gc ta        at at        at ta        gt             ttttatgcataaaacaatgtccacagttagtaagagattcaATG     ..................................................................................................................