                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:87 nt.    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-11.92 kcal/mol
Antiterminator:    Distance from promoter:34 nt. Size=65 nt.     Delta G=-11.99 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAATA-TAAAAT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAATAAAATTTGTACAAAACACTGTAAAATCAAAATTTAATGTTGAATTGGATACAG
AAGTTAGAATTATAGGTGAGGACAAATAAtagagtgaggaatcacattgattatttagaagtgactgtgattagaatgg
acatttacagtcacttttatgctataattaattaataaataagtattgaaattaaaacttaactacaaactatataaatagacaaataaaggaggcaagg
ttttATG

    CAC0511 --- CAC0512 --- CAC0513 --- CAC0514 --- CAC0515 --- dnaE Gene: CAC0511     GI: 15893802     BI number: CAC0511     GOG: COG1660     Description: Predicted P-loop containing kinase, similar to B.subtilis yvcJ Gene: CAC0512     GI: 15893803     BI number: CAC0512     GOG: COG0391     Description: Uncharacterized conserved protein, YbhK/UPF0052 family Gene: CAC0513     GI: 15893804     BI number: CAC0513     GOG: COG1481     Description: Uncharacterized conserved protein, similar to B.subtilis yvcL Gene: CAC0514     GI: 15893805     BI number: CAC0514     GOG: COG4109     Description: CBS domain, similar to B.subtilis ytoI Gene: CAC0515     GI: 15893806     BI number: CAC0515     GOG: NOG26415     Description: Uncharacterized conserved protein Gene: dnaE     GI: 15893807     BI number: CAC0516     GOG: COG0587     Description: DNA polimerase III, alpha chain (dnaE ga g  a at gc ta gc |  a at gt a  g ta At At Ta At At At         t C  a      a  g A  g      a  g G  a      g  a G  a      a  c A  g      t  a G  t      t  t T  g       at G  a       gt Gc        ta At        gc Tg        ta At        cg Tg        at Ta        gc At        ta At        gc             ttttatgctataattaattaataaataagtattgaaattaaaacttaactacaaactatataaatagacaaataaaggaggcaaggttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1660 Predicted P-loop-containing kinase ... can be seen here [S] COG0391 Uncharacterized conserved protein ... can be seen here [S] COG1481 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG4109 Predicted transcriptional regulator containing CBS domains ... can be seen here [L] COG0587 DNA polymerase III, alpha subunit ... can be seen here     ..................................................................................................................