                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-15.20 kcal/mol
Antiterminator: Size=64 nt.     Delta G= -6.12 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G= -6.01 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGCACAAGTTCAGAATAAGGGATGGATGCCATGGGTAAAAAATGGAGCTATAGCAGG
AACAGTTCAAGAAGGATTAAGAATGGAAGCTATAGAGATATACGTTGTTAAGAATAAT
ACACCTGTAGCTAATTTTATGGATAATAAAGTAGCAAATGCTCAATAAgaattttaaaggttaa
taattggaattttttaatgataaaaagatgctttcagaaattatatcaaatttctgaaagcatcttttatttttagaatatataaaactaatttttagaa
aattcaataatgaaagttatATG

    CAC0541 Gene: CAC0541     GI: 15893831     BI number: CAC0541     GOG: COG0500     Description: SAM-dependent methyltransferas   A G  T G  A TA AT TA TA        ta TA       t  a TG       g  t A  |      g  a AT       a  a TA        at CG        at GC        tg |  A       tg |  A       ta |  A       ta |  T       at |  G       at |  C       gt |  T       At |  C       At |  A      |  t |  A      T  a |  T      A  a       at |  A       At       t  c |  A       Cg       a  a |  g       Ta        ta |  a      |  t       ta |  a      |  a       at |  t      |  a       at |  t      C  a       at |  t      G  a       gc A  t      T  a       at T  a      A  g       cg G  a      A  a       ta Ta        At        ta Cg        Cg        ta Cg        Gc        cg At        At        gc                         atcttttatttttagaatatataaaactaatttttagaaaattcaataatgaaagttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [QR] COG0500 SAM-dependent methyltransferases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-16.80 kcal/mol Antiterminator: Size=64 nt.     Delta G= -6.12 kcal/mol Anti-antiterminator:   Size=43 nt.     Delta G= -4.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GAGCACAAGTTCAGAATAAGGGATGGATGCCATGGGTAAAAAATGGAGCTATAGCAGG AACAGTTCAAGAAGGATTAAGAATGGAAGCTATAGAGATATACGTTGTTAAGAATAAT ACACCTGTAGCTAATTTTATGGATAATAAAGTAGCAAATGCTCAATAAgaattttaaaggttaa taattggaattttttaatgataaaaagatgctttcagaaattatatcaaatttctgaaagcatcttttatttttagaatatataaaactaatttttagaa aattcaataatgaaagttatATG     CAC0541 Gene: CAC0541     GI: 15893831     BI number: CAC0541     GOG: COG0500     Description: SAM-dependent methyltransferas            ag           a  a           a  t           a  g           a  c            tt            at            gt            tc            aa            ag            ta ta        ta t  a       ta g  t       tt g  a       tt a  a      |  a at       t  t       at at       a  a      t  c tg        at       a  a tg        g        ta ta        g        ta ta       |         at at       |         at at       |         at gt       t         gc At       t         at At       a         cg |  t      a         ta T  a      t         ta A  a       a        ta At        a        cg Cg        t        gc Ta        t        ta                         tcttttatttttagaatatataaaactaatttttagaaaattcaataatgaaagttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [QR] COG0500 SAM-dependent methyltransferases ... can be seen here     ..................................................................................................................