                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:103 nt.    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -9.60 kcal/mol
Antiterminator:    Distance from promoter:56 nt. Size=58 nt.     Delta G= -3.75 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAAGA-TAAAAT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAAGAGACTGGGATGAAGAACATAGTAAAATGGGGAAAGGTATAACTTTAAGTAATG
AAGAGGTAAAAAGACTTAAAGAGATACTTAACGAAATGAATGTATAAagcttcaaataatagaag
tcataaaaaaaatctatcatcgtataattaggtgatagatttttttataagtttatttggaggaatgtttGTG

    CAC0546 Gene: CAC0546     GI: 15893836     BI number: CAC0546     GOG: NOG39022     Description: Uncharacterized membrane protein, homolog of Methanobacterium (2621593 ta a  a a  t a  a cg ta ta cg gt |  c |  a a  t A  a A  a T  a A  a T  a G  a        a T  a      t  a A  a      a  t At       t  t Gc       g  a |  t       cg |  a       tg T  t       at A  c       cg A  a       ta At        at Gc        ta Cg        cg At        ta             tttttttataagtttatttggaggaatgtttGTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:100 nt.    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-12.50 kcal/mol Antiterminator:    Distance from promoter:66 nt. Size=58 nt.     Delta G= -3.75 kcal/mol Anti-antiterminator:    Distance from promoter:74 nt.    Size=18 nt.     Delta G= -3.30 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTAAGA-TAAAAT. It has a score value of 66.27 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTAAGAGACTGGGATGAAGAACATAGTAAAATGGGGAAAGGTATAACTTTAAGTAATG AAGAGGTAAAAAGACTTAAAGAGATACTTAACGAAATGAATGTATAAagcttcaaataatagaag tcataaaaaaaatctatcatcgtataattaggtgatagatttttttataagtttatttggaggaatgtttGTG     CAC0546 Gene: CAC0546     GI: 15893836     BI number: CAC0546     GOG: NOG39022     Description: Uncharacterized membrane protein, homolog of Methanobacterium (2621593            ca           t  t           g  a           a  a            aa            ga            aa            ta            aa           |  a           |  t           a  c           t  t           a  a           a  t        a           a  c      t  a           c  a      a  t           t  t      t  t           t  c      g  a           c  g       cg            gt        tg            aa        at ta       |  t       cg a  a      |         ta a  t      A         at a  a      A         ta cg       T         cg ta        A        ta ta        T        at cg        G        at gt        T        at                         ttttataagtttatttggaggaatgtttGTG     ..................................................................................................................