                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-13.70 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGTTGGAGCAAGTGTAGATGGTACCTTTGGTAGCGGAACAAAAGCAAAAGTTGCAGC
TTGGCAGTCAAATCAGGGACTTATGGCTGATGGTGTTGTTGGATCGGCTACTTGGTCA
AAGCTATTAGATGAAAATTAAtaaaatataaatgaaaattgtccacaatggctatgtggaaagtaagatgtttttaacacatagc
catttttcttttttattacatatatataaaataatgttgactttgtggtaaaattgtaataaaattacactaaaatggtatagaatggaggtgagaaggA
TG

    CAC0555 Gene: CAC0555     GI: 15893845     BI number: CAC0555     GOG: COG2717     Description: Predicted membrane protei             a           g  t           a  g           a  t           t  t   g        gt g  c       at t  t       at a  a      a  a at       g  a cg        gc at        ta cg        gc cg        ta ta        at g  a       ta ta        cg tg        gc at        gc             atttttcttttttattacatatatataaaataatgttgactttgtggtaaaattgtaataaaattacactaaaatggtatagaatggaggtgagaaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2717 Predicted membrane protein ... can be seen here     ..................................................................................................................