                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-14.20 kcal/mol
Antiterminator:    Distance from promoter:63 nt. Size=38 nt.     Delta G= -3.60 kcal/mol
Anti-antiterminator:    Distance from promoter:45 nt.    Size=39 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGACA-TATAAT. It has a score value of 79.65 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGACATAACAAGATTTGCAACATATAATATCTTATTCGGCATATATTTCATACTTAG
AGTAACAAAGACAAGACTAAGCAGTGTAACAAAGAGTGTAGAGCCAATTGCTTAGatat
tgtaagttcagctgatagtttggctgaactttttgttttatttaaaatataataatataataactttatttttacattttatgatataattcttacatac
aagtgtaagggagagatgaaaATG

    CAC0556 Gene: CAC0556     GI: 15893846     BI number: CAC0556     GOG: COG2013     Description: Uncharacterised conserved protei   G         a A  A      G  t A  G      A  a AT       T  t CG       T  t AT        Cg |  A       Gt |  G       Ta |  A       Ta        ag |  G      A  |      t  t A  C      A  |       at T  C      C  |       gt G  A       Cg        tg TA        Gt        cg GT        At        gc AT        Gc        at CG       A  a       cg GC       T  |       ta AT       G  |       ta AT        Tg        gc TA        Gc        at CG        At        at                         tttgttttatttaaaatataataatataataactttatttttacattttatgatataattcttacatacaagtgtaagggagagatgaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2013 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:92 nt.    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.30 kcal/mol Antiterminator:    Distance from promoter:57 nt. Size=38 nt.     Delta G= -3.60 kcal/mol Anti-antiterminator:    Distance from promoter:18 nt.    Size=54 nt.     Delta G= -4.13 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGACA-TATAAT. It has a score value of 79.65 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGACATAACAAGATTTGCAACATATAATATCTTATTCGGCATATATTTCATACTTAG AGTAACAAAGACAAGACTAAGCAGTGTAACAAAGAGTGTAGAGCCAATTGCTTAGatat tgtaagttcagctgatagtttggctgaactttttgttttatttaaaatataataatataataactttatttttacattttatgatataattcttacatac aagtgtaagggagagatgaaaATG     CAC0556 Gene: CAC0556     GI: 15893846     BI number: CAC0556     GOG: COG2013     Description: Uncharacterised conserved protei   A G  C A  T A  A C  A A  G G  C        G A  A      T  C A  G      T  T AT       A  T CG       A  A AT        CG A  A       Ca TA        Gt GC        Aa A  A      G  |       ag G  A      A  |      t  t A  A      T  |       at TG        Gt        gt TA        Tt        tg CG        Gg        cg AT        At        gc TG       G  a       at AT       A  |       cg |  A      A  |       ta CG        Aa        ta TA        Cg        gc TG        At        at                         ttttgttttatttaaaatataataatataataactttatttttacattttatgatataattcttacatacaagtgtaagggagagatgaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2013 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................