Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-12.10 kcal/mol
Antiterminator: Size=78 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAAAGATGAAGTCAGAATTGATGGTAACTACGCTATAGCATGGTCTGATACACT
AGATTTTAGAGTCGAAAAATCAAGTAAAAGCTTAATTGGTTCTGCTGTTTCAGGAGAG
GGATTAGTGAATGTATATAGAGGAACAGGAAGAATTCTTATGGCACCTGTAAGATAAa
taattttgtataagaaaatccagtgagcatagctttcactggatttttatatttatgtccaaggtatttataatttagtaggtacatataataaaaaatg
tattatgtttaagtattggaggagctATG

    CAC0557


Gene: CAC0557     GI: 15893847     BI number: CAC0557     GOG: COG0501     Description: Predicted Zn-dependent protease with possible chaperone functio


            A
          C  C
           GC
           GT
           TG
           AT
           TA
           TA
           CG
           TA
          |  T
          |  A
          T  A
          A  a
          A  t
 AG       G  a
T  A      A  a
A  G       At
T  G       Gt
A  A       Gt
 TA        At
 GC        Cg
 TA        At
A  G      |  a
A  G      |  t
G  A      |  a
T  A      |  a
G  G      |  g
A  |      |  a
 TA       |  a
 TA       |  a
 AT       |  a
 GT        At         a
 GC        Gc       t  g
 GT        Gc       a  c
 AT       A  a      c  t
G  A      G  |       gt
A  |      A  |       at
G  |       Tg        gc
G  |       At        ta
 AT        Tg        gc
 CG       A  a       at
 TG        Tg        cg
T  C       Gc        cg
 TA        Ta        ta
 GC        At        at
                        ttttatatttatgtccaaggtatttataatttagtaggtacatataataaaaaatgtattatgtttaagtattggaggagctATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[O] COG0501 Zn-dependent protease with chaperone function ... can be seen here

    ..................................................................................................................