                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:153 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-23.70 kcal/mol
Antiterminator:    Distance from promoter:94 nt. Size=67 nt.     Delta G= -8.81 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TATAAT-TATAAT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATAATTATCTTAGTGATGATAATATAATTTGTGAAAATGAGAAAAATTTCAAGAAAG
TAGAAGAAGATAATATAGATTATATTGTTGACAACATACTGCTTAAATGTCCTCAGGT
TTCTCAAAAATATATTGATATTGTAAATGAAATGCTTTCTTTAGCTGAAAGAAAATAA
agtatcaagatggtttctataaggtacaccttgtagaaaccatctttttgacattattgtatagcaggtatacaatattaatATG

    CAC0559 --- CAC0560 Gene: CAC0559     GI: 15893849     BI number: CAC0559     GOG: COG1846     Description: Transcriptional regulator, MarR/EmrR family Gene: CAC0560     GI: 15893850     BI number: CAC0560     GOG: COG0477     Description: Integral membrane protein similar to antibiotic resistance protein B.subtili   A T  G T  C T  T CG TA TA TA CG G  A T  A A  A A  A A  T G  A T  A A  | A  | A  | T  |       ac G  |      t  a Ta        gc Tg        gc At        at Ta        at At        tg Gc        at Ta        ta Ta        cg |  g       ta A  a       ta T  t       ta A  g       gc Tg        gc At        ta At        at At        gc             tttttgacattattgtatagcaggtatacaatattaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1846 Transcriptional regulators ... can be seen here [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................