                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-19.00 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcattatatatattaataaccttttgtagaggtgctttaagtcaagagtaaccgtttggagttggcaaacttagatgaacggtaaaaggggcttttag
ccgaagcatttagattggcagatttatttgctggcttttcatacaacatatgaatggctgtcactttattagttagttattaggtaagtggagcgctaca
aggtacacaagattgcatttattagcggcaagggtgttcctttgccgcttatttttataaagaatattgtggcgcaaaaaaagataaagaggtgtttaaa
GTG

    lisA Gene: lisA     GI: 15893897     BI number: CAC0608     GOG: COG0019     Description: Diaminopimelate decarboxilase, lis   t a  t t  a t  g t  c a  g       gt cg       t  t gc        gc ta        gc ta        gt a  g       at g  g       at a  |       cg a  |       gc cg        gc at        cg cg        gc at        at             tatttttataaagaatattgtggcgcaaaaaaagataaagaggtgtttaaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0019 Diaminopimelate decarboxylase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................