                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:155 nt.    Distance to gene:18 nt.     Distance to run of Ts=3 nt.   Size=28 nt.     Delta G=-16.70 kcal/mol
Antiterminator:    Distance from promoter:113 nt. Size=50 nt.     Delta G= -8.96 kcal/mol
Anti-antiterminator:    Distance from promoter:72 nt.    Size=46 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATG-TAGCTT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATGTTTTAGGCGGCTTAATTTTAGCTTTCTGTTCCGTAAAACTAACAGACTTTGT
ATTTGCTAAACTTCAACCTAAGCTTCAACCCCTTATAAATAAATACTATTATAGAACT
GCTGATAAAACATTAGCAAGCAATAAGTCAGTTTCAACAACATAAataaaatttatttttatacaac
ctgaggctgaatcaccatcgattcagcctttgattttgtttaataggagagtatacaactATG

    CAC0632 Gene: CAC0632     GI: 15893920     BI number: CAC0632     GOG: COG0637     Description: Predicted phosphatas             t           t  a   A       t  t A  A       at A  C       at TA        at AT        at GT        ta TA        at CG       A  a GC       A  c TA       T  a C  A      A  a A  G      C  c       ca A  C      A  c      c  t G  A      A  |      a  c A  |      C  |       cg TA       A  |       ta AT        At        at TA        Cg        at TA        Ta        gc |  G       Tg        ta |  T       Tg        cg A  C       Gc        gc TA        At        gc CG        Cg        at AT        Ta        gt                         tgattttgtttaataggagagtatacaactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0637 Predicted phosphatase/phosphohexomutase ... can be seen here     ..................................................................................................................