                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:153 nt.    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-20.30 kcal/mol
Antiterminator:    Distance from promoter:126 nt. Size=39 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:    Distance from promoter:86 nt.    Size=48 nt.     Delta G= -3.29 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaaa-gacaat. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaaatacaaatttcaactgaaagacaatcagctgcaaattatgctgaaaaatggtgtacttcaagaaatcctgttacaacagaaaaacttacatttga
tatgtcaacttgtacaggaagaaatgacttaaatgcacttttatgctatagtacgatgaaatccttgaaatcgaatgattaaaggggttgtttcaaaact
aatttagttttgaaatggctccttttctatatataaaaaatgtgagttccgaagaactcacattaattgtataattaagctATG

    CAC0657 --- CAC0656 Gene: CAC0657     GI: 15893945     BI number: CAC0657     GOG: COG3666     Description: Predicted transposase (5' fragment) Gene: CAC0656     GI: 15893944     BI number: CAC0656     GOG: COG3666     Description: Predicted transposase (3' fragment tt t  t c  a at cg gc        aa t  t      g  t        t a  a       cg       a  t a  t       ta        at a  |       at        ta t  |       at        cg ta       a  a       at cg       g  a       at at        ta        at |  a       tg        at |  c       cg        cg g  g       cg        ta t  a       tg        ta a  t       at        ta a  g      |  t      g  t a  a      |  g      t  g g  a      |  t       tg a  a       at        gc at        at        gt gc        gc        gc gc        ta        gc                         ttttctatatataaaaaatgtgagttccgaagaactcacattaattgtataattaagctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3666 Transposase and inactivated derivatives ... can be seen here [L] COG3666 Transposase and inactivated derivatives ... can be seen here     ..................................................................................................................