                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:207 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAAAGAAAAAGTAATTGATTTTAATGATTATTGCAATAAATAAttttatgtatataaatcgggatg
gtttctgctgtttcgatttttcttttatataagatttgtaattgaaaattgtaccgaattttttacggtaatatattaaagagtacatatatattaagtt
ttacgcttgggttttatatggataatcgttatcattagactttttagatattttacactataataggttttgacatatataaaaattattaatgcaaatt
tttaagttaatgttttgaaaggtggaattttatATG

    CAC0688 --- ntH Gene: CAC0688     GI: 15893976     BI number: CAC0688     GOG: COG0204     Description: 1-acyl-sn-glycerol-3-phosphate acyltransferase Gene: ntH     GI: 15893977     BI number: CAC0689     GOG: COG0177     Description: Predicted endonuclease, gene nt AA T  t At At At Ta        tc A  |      t  t At        tg Cg        gc Gt        gt Ta        tg |  t       at |  a      g  t T  t      g  t A  a       gc Ta        cg Ta        ta At        at Gc        at Tg        at             ttcttttatataagatttgtaattgaaaattgtaccgaattttttacggtaatatattaaagagtacatatatattaagttttacgcttgggttttatatggataatcgttatcattagactttttagatattttacactataataggttttgacatatataaaaattattaatgcaaatttttaagttaatgttttgaaaggtggaattttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0204 1-acyl-sn-glycerol-3-phosphate acyltransferase ... can be seen here [L] COG0177 Predicted EndoIII-related endonuclease ... can be seen here     ..................................................................................................................