                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:195 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -8.00 kcal/mol
Antiterminator:    Distance from promoter:164 nt. Size=45 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:    Distance from promoter:142 nt.    Size=45 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGATT-GAAAAT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGATTTAATAGGAAAATGGGTTGAAAATGGCGAAGTACCAAATGATATGGAGTTACT
TGGAAGAATAACAAAAAATATATGCTTTAATAATGCTAATAATTACTTCGAAATGGGA
CTATAAtcattccattttattgtaattaaaaataatatagtttatttagggactattgtgttatattatgaatatgctaatatgtttatgaggaag
ccagtttactttcttaagttatattatgataacttaagttttattttggactcctaatacttgaaaggtgtgttgtaaaATG

    CAC0693 Gene: CAC0693     GI: 15893981     BI number: CAC0693     GOG: COG1609     Description: Transcriptional regulator of the LacI famil ta        gt c  a      a  t gt       c  t ta       c  a at        gc tg        at at        at at        gt gt        gc ta        at at        gt        ta tg        ta       t  t ta       a  a      a  g a  g      t  g       ta t  g      t  t       at a  a      t  |       ta ta        gt        ta tg        ta        gc gc        at        at t  |       ta        at gc        at        ta ta        at        ta tg        ta        cg                         ttttattttggactcctaatacttgaaaggtgtgttgtaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1609 Transcriptional regulators ... can be seen here     ..................................................................................................................