                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:51 nt.    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-10.50 kcal/mol
Antiterminator:    Distance from promoter:19 nt. Size=43 nt.     Delta G= -3.00 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATG-GATACT. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATGGAAAAATAGTTGTTCCAGATACTGTTGATAAGGCGCAAACATTTAAGACGGA
TCAAATAAAATAAatttagaaaagctgggttagttgctcagctttttatagaaatataaagatttttactgtaaaaaagtagttgaggagg
atttgaATG

    CAC0703 --- CAC0704 --- CAC0705 Gene: CAC0703     GI: 15893991     BI number: CAC0703     GOG: COG3845     Description: Sugar ABC-transporter, ATP-ase component Gene: CAC0704     GI: 15893992     BI number: CAC0704     GOG: COG4603     Description: Sugar ABC transporter, permease protein Gene: CAC0705     GI: 15893993     BI number: CAC0705     GOG: COG1079     Description: Sugar ABC transporter, permease protei   A C  A G  A C  C G  A GT AT         A AT       T  A TA       A  a A  A       At G  |       At TG        At TA        Ta GC       A  g TG       A  a CG       A  a A  |      C  a TA       T  a        g AT       A  g      a  t GC        Gc       t  t A  A       Gt        tg C  |       Cg        gc C  |      A  g       gt TA       G  g       gc TA        At        ta GT        At        cg TA        Ta        gc TA        Tg        at                         ttttatagaaatataaagatttttactgtaaaaaagtagttgaggaggatttgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3845 ABC-type uncharacterized transport systems, ATPase components ... can be seen here [R] COG4603 ABC-type uncharacterized transport system, permease component ... can be seen here [R] COG1079 Uncharacterized ABC-type transport system, permease component ... can be seen here     ..................................................................................................................