Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:148 nt.    Distance to gene:52 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-20.50 kcal/mol
Antiterminator:    Distance from promoter:89 nt. Size=65 nt.     Delta G= -4.77 kcal/mol
Anti-antiterminator:    Distance from promoter:74 nt.    Size=45 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGGAT-TATACT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGGATTTACAAGTCAAAAGGGGTATACTTTAGTTCCTATAGCATTATATTTAAAGAA
TAGAAGAGTCAAGGTAAAGTTGGCGGTTGCTGTAGGTAAGAAGAATTACGATAAGAGG
GACGCTTTAAAGGAAAAAGATGCTAGACGTGAAATAGATAGAGCTATGAAAAATAATA
GGTAGagtggtgtaagtttattaatttacaccactcttttatttctgttcttaatatattattatggtgtataatatatattaaggtaaacatgAT
G

    CAC0717


Gene: CAC0717     GI: 15894005     BI number: CAC0717     GOG: -------     Description: Predicted membrane protei


           AG
          T  A
          A  G
           GC
           AT
           TA
           AT
          |  G
          A  A
          A  A
          G  A
          T  A
          G  A
          C  T
  G       A  A
A  G      G  A
A  A       AT
A  A       TA
 TA        CG
 TA       G  G
 TA       T  |
 CG       A  |
G  A      G  |       at
C  T      A  |      t  t
A  G      A  |       ta
 GC       A  |       ta
 GT       A  |       gt
G  A      A  |       at
A  G      G  |       at
G  A      G  |       ta
A  |      A  |       gc
A  |      A  |       ta
T  |       AT        gc
A  |       TA        gc
 GC        TG        ta
 CG        Ta        gc
 AT        Cg        at
 TG        Gt        Gc
 TA        Cg        At
                        tttatttctgttcttaatatattattatggtgtataatatatattaaggtaaacatgATG


    ..................................................................................................................