                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:167 nt.    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -9.64 kcal/mol
Antiterminator:    Distance from promoter:116 nt. Size=64 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaaat-tattat. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaaattaaaactgtgaggaaaattattatgtaatttaagtagatttatttaagcaaaattgaagacaattatcaatttattaaaaaagttgctttttta
tgggttcgtttttgcaatttgatttttattttgaatataatttacttttttatcacataataaaattcttaaaaagaatatctcttttaagtttattagt
gttgtgaaaaaggtaagaaccgcagcactttttttgttgcgtaaatttaaaggagatgaattatATG

    CAC0752 --- CAC0753 Gene: CAC0752     GI: 15894039     BI number: CAC0752     GOG: NOG41562     Description: Homolog of eukaryotic DNA ligase III Gene: CAC0753     GI: 15894040     BI number: CAC0753     GOG: COG0617,COG4639     Description: PolyA polymerase related protein (HD hydrolase) and P-loop ATP-ase domai   t a  a a  t gc at |  c at at at at ta ta cg t  | t  | a  | at at at ta        gt at       g  a at       a  a |  a      a  g tg       a  a at       a  a cg       a  c at        gc c  t       tg tg        gc at        ta tg        tg ta        gc ta        ta ta        gc ta        at             ttttttgttgcgtaaatttaaaggagatgaattatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0617 tRNA nucleotidyltransferase/poly(A) polymerase ... can be seen here [R] COG4639 Predicted kinase ... can be seen here     ..................................................................................................................