                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:80 nt.    Distance to gene:79 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.30 kcal/mol
Antiterminator:    Distance from promoter:47 nt. Size=45 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:    Distance from promoter:30 nt.    Size=22 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-AAAAGT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAGCATGCTTAGCTTTATAGAAAAGTACAGCAAACATTTGGATTCAGAAATAAA
GAAACTTGGTATAGATACTAAGTTAGAGTAAattttaatagtaaaatgataggcagtctaattttatttaaactagg
ctgcatttttatttttttgttgacatggaaacaaaaagttgatatgataaacatgtttcccaggaaacaaaattaataactttgagaggagaattcaaAT
G

    CAC0762 Gene: CAC0762     GI: 15894049     BI number: CAC0762     GOG: COG0477     Description: Permease, probably tetracycline resistance protei            ta           a  g            at            ta            ta            ta            ta            at           |  g           |  a           |  t        t           A  a      a  t           A  g      t  t            Tg        ta AG        Gc        ta T  A      |  a       ta AT       |  g      a  c TA        At        at GC        Gc        ta GT        At        cg TA        Ta        tg TA        Ta        gc CG        Gt        at AT        At        cg AT        At        gc                         atttttatttttttgttgacatggaaacaaaaagttgatatgataaacatgtttcccaggaaacaaaattaataactttgagaggagaattcaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_acetobutylicum                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:80 nt.    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.30 kcal/mol Antiterminator:    Distance from promoter:46 nt. Size=45 nt.     Delta G= -5.20 kcal/mol Anti-antiterminator:    Distance from promoter:30 nt.    Size=22 nt.     Delta G= -6.90 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGAAA-AAAAGT. It has a score value of 60.91 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGAAAGCATGCTTAGCTTTATAGAAAAGTACAGCAAACATTTGGATTCAGAAATAAA GAAACTTGGTATAGATACTAAGTTAGAGTAAattttaatagtaaaatgataggcagtctaattttatttaaactagg ctgcatttttatttttttgttgacatggaaacaaaaagttgatatgataaacatgtttcccaggaaacaaaattaataactttgagaggagaattcaaAT G     CAC0762 Gene: CAC0762     GI: 15894049     BI number: CAC0762     GOG: COG0477     Description: Permease, probably tetracycline resistance protei            at           a  a            tg            tt            ta            ta            aa            Aa           |  t           |  g           |  a        t           A  t      a  t           T  a      t  t            Gg        ta AG        Ag        ta T  A      |  c       ta AT       |  a      a  c TA        Gg        at GC        At        ta GT        Tc        cg TA        Tt        tg TA        Ga        gc CG        Aa        at AT        At        cg AT        Tt        gc                         atttttatttttttgttgacatggaaacaaaaagttgatatgataaacatgtttcccaggaaacaaaattaataactttgagaggagaattcaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................