Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:132 nt.    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-16.70 kcal/mol
Antiterminator:    Distance from promoter:73 nt. Size=79 nt.     Delta G= -6.96 kcal/mol
Anti-antiterminator:    Distance from promoter:49 nt.    Size=51 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTCC-CAAAAT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTCCGCAGCATATTGAAATTACAAAATACCTAAAGGATGTAGCAAATTCCTTTGAA
GGTAGATGGCTTTAActagaaaaatatttctaaagttaggcttttataaaatttaaagtgtgagatattttattgtagattactaaacg
aaataataagaagataataccattggtttttgtaggaactaatggtattatttttgaaataaaaaaacaaatatgatatattaaaaagttaggaggtgtt
ttaaataaaagagTTG

    CAC0768


Gene: CAC0768     GI: 15894055     BI number: CAC0768     GOG: COG0583     Description: Transcriptional regulator, LysR famil


            t
          c  a
          a  a
          t  a
          t  c
          a  g
          g  a
          a  a
           ta
           gt
           ta
           ta
           at
           ta
           ta
 at        tg
t  a       ta
 ta       a  a
 ta       t  g
 ta       a  a
c  |      g  t
 gt       a  a
 gt       g  |
 at        ta        gt
 ta        gt       t  a
 ta        ta        tg
g  a       gc        tg
a  g      |  c       ta
a  t      a  a       ta
a  g       at        gc
t  t       at        gt
 cg        tg        ta
 ta        tg        ta
 tg       t  t       at
 ta        at        cg
 at        at        cg
 ta        at        at
 at        at        ta
 at        tg        at
 at        at        at
 at        ta        ta
                        tttttgaaataaaaaaacaaatatgatatattaaaaagttaggaggtgttttaaataaaagagTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG0583 Transcriptional regulator ... can be seen here

    ..................................................................................................................