                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:118 nt.    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -8.30 kcal/mol
Antiterminator:    Distance from promoter:84 nt. Size=42 nt.     Delta G= -3.60 kcal/mol
Anti-antiterminator:    Distance from promoter:67 nt.    Size=37 nt.     Delta G= -6.92 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAACA-TATTAT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAACAAATGATAAACTTGTACTTTATTATCAGGTTTATGCCTATACACCATATTACT
ATGGATTATTTAGGATTCCTATACCTTACACAGAAATAAAGAATCTTTTAGGACCAAT
GAGTCCTATAAATAATCTTATATAAtatataaagggtcatgtaaagatgactctttttatatttggttaaaattttgaagat
aatattgtataattagagtaaggatttactgttaaggagatttttATG

    CAC0860 Gene: CAC0860     GI: 15894147     BI number: CAC0860     GOG: COG0745     Description: Two-component response regulato             A           T  T           T  A AT       C  T A  G      T  A C  A      A  A CG        At AT        Ta GC        At GC       A  a AT        At TA        Ta        aa |  T      A  a      t  a T  A       Ta       g  g T  A       Cg        ta T  A       Cg        at C  T       Tg        cg T  A      G  |       ta A  A       At        gc AT        Gc        gt GC        Ta        gc AT        At        at                         ttttatatttggttaaaattttgaagataatattgtataattagagtaaggatttactgttaaggagatttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here     ..................................................................................................................