                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:93 nt.    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-11.30 kcal/mol
Antiterminator:    Distance from promoter:66 nt. Size=42 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:    Distance from promoter:13 nt.    Size=61 nt.     Delta G= -5.07 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTTAA-TAGAAT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTTAATCTCCATTTTAGTGTTCTAGAATGGCTTGGAAGCGGATGTATTATACTTACA
ACGATAATTCTTTCTACGGTAAAAAATAGTAGTAATTAAatacatattttatagaataaactatagagatt
atgagttttatatttacttataatcttttttttcttagtaataatatgtaagactaaatttgacaaaaaaaatgttactatatataatagttataaaata
taacaaaaaaataggagtaactaacATG

    CAC0876 --- cfa Gene: CAC0876     GI: 15894163     BI number: CAC0876     GOG: COG1846     Description: Transcriptional regulator, MarR/EmrR family Gene: cfa     GI: 15894164     BI number: CAC0877     GOG: COG2230     Description: Cyclopropane fatty acid synthas TA C  C T  G T  G T  T C  A T  A T  A A  A A  A       ta T  A      a  a A  T      a  a G  A       gc CG        at         t AT        ta       a  a A  A       at       t  t CG        ta       t  t AT        tg       t  t TA        ta        ta TA        tg        gc C  T      |  a       at AT       |  t       gt TA        at        ta A  |       ta        at TA        at        ta Ta        cg        ta At       a  a       at Ta        tg        gc Gc        at        at Ta        At        gt At        At        at                         tttttcttagtaataatatgtaagactaaatttgacaaaaaaaatgttactatatataatagttataaaatataacaaaaaaataggagtaactaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1846 Transcriptional regulators ... can be seen here [M] COG2230 Cyclopropane fatty acid synthase and related methyltransferases ... can be seen here     ..................................................................................................................