                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-19.00 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTAAGAGTATAACAGTTGTTAGAATGGAGGTACCTTGCTGTTCAGGCATAGTTTCAG
CAGTAAAGACTGCTATGCTTGAAGCAAAAGTTATAGTACCTTTTAGAGAAGTTATTAT
AGGAACTAATGGTGAAATTAGATAAaaataagaacctattaaaataaatgggcgctgctttaatgcagtgtccatttatttt
aagtttaaatagaaacgtatatagcaaaatttagtataaaggtaataaagtcttggtgaattctatataatatattcaaaatggaattaaggtggaaaga
atATG

    CAC0886 Gene: CAC0886     GI: 15894173     BI number: CAC0886     GOG: -------     Description: Hypothetical protei            ta           t  a aa       t  t a  t       cg a  a       gc ta        ta ta        cg at        gt tg        cg cg        gt cg        gc a  c       gc a  g       ta gc        at at        at             tattttaagtttaaatagaaacgtatatagcaaaatttagtataaaggtaataaagtcttggtgaattctatataatatattcaaaatggaattaaggtggaaagaatATG     ..................................................................................................................