                                                                        Gene putatively regulated by attenuation in C_acetobutylicum

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:114 nt.    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-17.80 kcal/mol
Antiterminator:    Distance from promoter:99 nt. Size=31 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:    Distance from promoter:99 nt.    Size=10 nt.     Delta G= -1.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tcgaaa-taaaat. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcgaaatgtgaaattaatatatactaaaatttttatagtagacggcagcgggtacgcccgattaaagcgttatggtatgttagtacctaagttatgagtt
gtcatattagtttttatgtgataattagagtggaaccgcggagtaaacttctgcctctatattttagggggggaagtttttttatttaaaaattaagtac
tcttagtatgcaatttctataaagtatattaaaacttgttttttataaattttaaggggagtgtatattATG

    CAC0929 --- metB --- CAC0931 Gene: CAC0929     GI: 15894216     BI number: CAC0929     GOG: COG0500     Description: SAM-dependent methyltransferase Gene: metB     GI: 15894217     BI number: CAC0930     GOG: COG0626     Description: Cystathionine gamma-synthase Gene: CAC0931     GI: 15894218     BI number: CAC0931     GOG: COG0031     Description: Cysteine synthas                       t             a       a  t           a  a      t  t           t  c       at            gt        ta            at        cg            gc        tg            gt        cg            cg        cg            gc       g  g           c  c       tg           c  |       cg           a  |       ta aa        at        ta g  c       gc        cg gc        gt        at tg        ta        at gc        gt        at                         ttttatttaaaaattaagtactcttagtatgcaatttctataaagtatattaaaacttgttttttataaattttaaggggagtgtatattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [QR] COG0500 SAM-dependent methyltransferases ... can be seen here [E] COG0626 Cystathionine beta-lyases/cystathionine gamma-synthases ... can be seen here [E] COG0031 Cysteine synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................